Human MFI2(Melanotransferrin) ELISA Kit
Order Now: [email protected]
 ELISA Kit) Human Melanotransferrin (MFI2) ELISA Kit |
|
DLR-MFI2-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Melanotransferrin (MFI2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Melanotransferrin (MFI2) in samples from serum, plasma or other biological fluids. |
|
Human Melanotransferrin (MFI2) ELISA Kit |
|
RDR-MFI2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
|
Human Melanotransferrin (MFI2) ELISA Kit |
|
RDR-MFI2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
|
Human Melanotransferrin (MFI2) ELISA Kit |
|
RD-MFI2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
|
Human Melanotransferrin (MFI2) ELISA Kit |
|
RD-MFI2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
ELISA Kit) Human Melanotransferrin (MFI2)ELISA Kit |
|
201-12-2492 |
SunredBio |
96 tests |
EUR 440 |
- This Melanotransferrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
 ELISA kit) Human Melanotransferrin(MFI2) ELISA kit |
|
CSB-EL013754HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Melanotransferrin (MFI2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
|
Human Melanotransferrin(MFI2) ELISA kit |
|
1-CSB-EL013754HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Melanotransferrin(MFI2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA Kit) Human MFI2(Melanotransferrin) ELISA Kit |
|
EH3348 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: P08582
- Alias: MFI2/CD228/MAP97/MFI2/MTF/p97/antigen p97(melanoma associated) identified by monoclonal antibodies 133.2 and96.5/CD228/CD228 antigen/FLJ38863/MAP97Melanoma-associated antigen p97/melanotrans
- Show more
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
|
Human Melanotransferrin (MFI2) ELISA Kit |
|
SEB677Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids. |
|
Human Melanotransferrin (MFI2) ELISA Kit |
|
SEB677Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids. |
|
Human Melanotransferrin (MFI2) ELISA Kit |
|
SEB677Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids. |
|
Human Melanotransferrin (MFI2) ELISA Kit |
|
SEB677Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids. |
|
Human Melanotransferrin (MFI2) ELISA Kit |
|
4-SEB677Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Melanotransferrin elisa. Alternative names of the recognized antigen: CD228
- MAP97
- MTF1
- Antigen P97(Melanoma Associated)
- Membrane-Bound Transferrin-Like Protein
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Melanotransferrin (MFI2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
) Rabbit Melanotransferrin (Mfi2) |
|
1-CSB-EP013754RB |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 91.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Rabbit Melanotransferrin(Mfi2),partial expressed in E.coli |
 Antibody) Melanotransferrin (MFI2) Antibody |
|
20-abx005099 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
 Antibody) Melanotransferrin (Mfi2) Antibody |
|
20-abx111013 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Melanotransferrin (MFI2) Antibody |
|
20-abx128153 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
|
Melanotransferrin (MFI2) Antibody |
|
20-abx173530 |
Abbexa |
|
|
|
|
|
Melanotransferrin (MFI2) Antibody |
|
abx235149-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
) Recombinant Melanotransferrin (MFI2) |
|
4-RPB677Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P08582
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 41.3kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human Melanotransferrin expressed in: E.coli |
) ELISA kit for Human MFI2 (Melanotransferrin) |
|
E-EL-H2405 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's MFI2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MFI2. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Human MFI2 (Melanotransferrin) in samples from Serum, Plasma, Cell supernatant |
|
ELISA kit for Human MFI2 (Melanotransferrin) |
|
ELK3234 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Melanotransferrin (MFI2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Melanotra
- Show more
|
|
Description: A sandwich ELISA kit for detection of Melanotransferrin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Human Melanotransferrin (MFI2) |
|
KTE61638-48T |
Abbkine |
48T |
EUR 332 |
- Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Human Melanotransferrin (MFI2) |
|
KTE61638-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Human Melanotransferrin (MFI2) |
|
KTE61638-96T |
Abbkine |
96T |
EUR 539 |
- Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 CLIA Kit) Human Melanotransferrin (MFI2) CLIA Kit |
|
abx197271-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
|
Human Melanotransferrin (MFI2) CLIA Kit |
|
20-abx492980 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
 Protein) Human Melanotransferrin (MFI2) Protein |
|
20-abx167031 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
) ELISA kit for Rabbit Melanotransferrin (MFI2) |
|
KTE90099-48T |
Abbkine |
48T |
EUR 354 |
- The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Rabbit Melanotransferrin (MFI2) |
|
KTE90099-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Rabbit Melanotransferrin (MFI2) |
|
KTE90099-96T |
Abbkine |
96T |
EUR 572 |
- The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) ELISA kit for Mouse Melanotransferrin (MFI2) |
|
KTE71043-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Mouse Melanotransferrin (MFI2) |
|
KTE71043-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
|
ELISA kit for Mouse Melanotransferrin (MFI2) |
|
KTE71043-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
) CLIA kit for Human MFI2 (Melanotransferrin) |
|
E-CL-H1410 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's MFI2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MFI2 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
|
Description: A sandwich CLIA kit for quantitative measurement of Human MFI2 (Melanotransferrin) in samples from Serum, Plasma, Cell supernatant |
 Polyclonal Antibody (Human)) Melanotransferrin (MFI2) Polyclonal Antibody (Human) |
|
4-PAB677Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2) |
 Polyclonal Antibody (Human), APC) Melanotransferrin (MFI2) Polyclonal Antibody (Human), APC |
|
4-PAB677Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Melanotransferrin (MFI2) Polyclonal Antibody (Human), Biotinylated |
|
4-PAB677Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Melanotransferrin (MFI2) Polyclonal Antibody (Human), Cy3 |
|
4-PAB677Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Melanotransferrin (MFI2) Polyclonal Antibody (Human), FITC |
|
4-PAB677Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Melanotransferrin (MFI2) Polyclonal Antibody (Human), HRP |
|
4-PAB677Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Melanotransferrin (MFI2) Polyclonal Antibody (Human), PE |
|
4-PAB677Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with PE. |
 Polyclonal Antibody (Human), APC-Cy7) Melanotransferrin (MFI2) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAB677Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with APC-Cy7. |
 Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-100ug |
|
QP6357-ec-100ug |
EnQuireBio |
100ug |
EUR 707 |
 Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-10ug |
|
QP6357-ec-10ug |
EnQuireBio |
10ug |
EUR 326 |
 Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-1mg |
|
QP6357-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
 Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-200ug |
|
QP6357-ec-200ug |
EnQuireBio |
200ug |
EUR 1115 |
 Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-500ug |
|
QP6357-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
 Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-50ug |
|
QP6357-ec-50ug |
EnQuireBio |
50ug |
EUR 435 |
 ELISA Kit) Human Melanotransferrin (MELTF) ELISA Kit |
|
20-abx152303 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
|
Human Melanotransferrin (MELTF) ELISA Kit |
|
abx252749-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Chicken Melanotransferrin (MELTF) ELISA Kit |
|
abx354703-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Monkey Melanotransferrin (MELTF) ELISA Kit |
|
abx355024-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Pig Melanotransferrin (MELTF) ELISA Kit |
|
abx355170-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rabbit Melanotransferrin (MELTF) ELISA Kit |
|
abx355246-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Sheep Melanotransferrin (MELTF) ELISA Kit |
|
abx355389-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 MFI2 antibody |
|
70R-18494 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal MFI2 antibody |
|
MFI2 antibody |
|
70R-10040 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Affinity purified rabbit polyclonal MFI2 antibody |
|
MFI2 antibody |
|
39073-100ul |
SAB |
100ul |
EUR 252 |
 MFI2 Antibody |
|
1-CSB-PA013754GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against MFI2. Recognizes MFI2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 MFI2 siRNA |
|
20-abx924039 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
MFI2 siRNA |
|
20-abx924040 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-MFI2 |
|
YF-PA13138 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to MFI2 |
 Human MFI2 shRNA Plasmid |
|
20-abx952883 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MFI2 Recombinant Protein (Human) |
|
RP019246 |
ABM |
100 ug |
Ask for price |
 MFI2 Blocking Peptide |
|
33R-1830 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MFI2 antibody, catalog no. 70R-10040 |
 MFI2 Conjugated Antibody |
|
C39073 |
SAB |
100ul |
EUR 397 |
 MFI2 cloning plasmid |
|
CSB-CL013754HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 909
- Sequence: atgcggggtccgagcggggctctgtggctgctcctggctctgcgcaccgtgctcggtggcatggaggtgcggtggtgcgccacctcggacccagagcagcacaagtgcggcaacatgagcgaggccttccgggaagcgggcatccagccctccctcctctgcgtccggggcacctc
- Show more
|
|
Description: A cloning plasmid for the MFI2 gene. |
 MFI2 Rabbit pAb |
|
A6653-100ul |
Abclonal |
100 ul |
EUR 308 |
|
MFI2 Rabbit pAb |
|
A6653-200ul |
Abclonal |
200 ul |
EUR 459 |
|
MFI2 Rabbit pAb |
|
A6653-20ul |
Abclonal |
20 ul |
EUR 183 |
|
MFI2 Rabbit pAb |
|
A6653-50ul |
Abclonal |
50 ul |
EUR 223 |
 anti- MFI2 antibody |
|
FNab05149 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: antigen p97(melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
- Uniprot ID: P08582
- Research Area: Immunology
|
|
Description: Antibody raised against MFI2 |
 Anti-MFI2 antibody |
|
STJ28736 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. |
) Anti-MFI2 (1F7) |
|
YF-MA14236 |
Abfrontier |
200 ul |
EUR 363 |
|
Description: Mouse monoclonal to MFI2 |
 (pORF)) MFI2 ORF Vector (Human) (pORF) |
|
ORF006416 |
ABM |
1.0 ug DNA |
EUR 95 |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
 Mouse MFI2 shRNA Plasmid |
|
20-abx974022 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) MFI2 Recombinant Protein (Mouse) |
|
RP150407 |
ABM |
100 ug |
Ask for price |
) MFI2 Recombinant Protein (Rat) |
|
RP211520 |
ABM |
100 ug |
Ask for price |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
) MFI2 sgRNA CRISPR Lentivector set (Human) |
|
K1296301 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (pORF)) MFI2-AS1 ORF Vector (Human) (pORF) |
|
ORF023512 |
ABM |
1.0 ug DNA |
Ask for price |
 Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
|
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
|
 CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
Human MFI2(Melanotransferrin) ELISA Kit
Human Melanotransferrin, MFI2 ELISA KIT ELISA Kit)
Human Melanotransferrin(MFI2)ELISA Kit 
Rabbit Melanotransferrin, Mfi2 ELISA KIT 
Mouse Melanotransferrin, Mfi2 ELISA KIT ELISA Kit)
Rat Melanotransferrin(MFI2)ELISA Kit ELISA Kit)
Mouse Melanotransferrin(MFI2)ELISA Kit 
MFI2 ELISA KIT|Human